Products Market Alerts MyCollection Price Database Become a Partner Gallery ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Adam Hayes, Ph.D., CFA, is a financial writer with 15+ years Wall Street experience as a derivatives trader. Besides his extensive derivative trading expertise, Adam is an expert in economics and ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results